Primer Workbook

THINK AND DO BOOK Fun With Our Friends Primer 1965 Workbook
THINK AND DO BOOK Fun With Our Friends Primer 1965 Workbook
$25.00
Time Remaining: 16d 15h 4m
Buy It Now for only: $25.00

Vintage Childrens Pre Primer Reader Workbook 1940s The Alice and Jerry Books
Vintage Childrens Pre Primer Reader Workbook 1940s The Alice and Jerry Books
$24.00
Time Remaining: 29d 20h 30m
Buy It Now for only: $24.00

Vintage 40s MOTHER HUBBARD School Primer WORKBOOK Unused As Is
Vintage 40s MOTHER HUBBARD School Primer WORKBOOK Unused As Is
$29.99
Time Remaining: 9d 34m
Buy It Now for only: $29.99

Scott Foresman UNUSED Old School Workbook Primer + Picture Dictionary Gazetteer
Scott Foresman UNUSED Old School Workbook Primer + Picture Dictionary Gazetteer
$22.00
Time Remaining: 5d 18h 56m
Buy It Now for only: $22.00

Primer Workbook
Primer Workbook

How to Develop Successful Work Teams using Rhetorical Maneuvers

Twelve Solutions for Effective Team Building Maneuvers

The talk in the workplace during the uncertainties in the global markets centers around the many nuances about how to become a team, the differences between teams and groups, what it takes to work as a team and how to make the team more effective, but few people have come to understand what it really takes to develop a great team that performs with extraordinary results! Being a part of a team that most can count on, in the broadest sense, requires the right people coming together with skills and talents to compliment one another to achieve the desired effects of the sponsoring organization and leadership. It has much to do with the people possessing the passion to be great, in order for their behaviors to stimulate great outcomes and their understanding of the future picture – the mission and objectives – and how to achieve the overall purpose of the organization.

People selected to become a member of a team must be prepared to contribute to the environment and overall success of the organization. They must put their personal feeling aside and work towards a significant level of Personal Proficiency that translates into increased levels of Professional Mastery. When assigned to a specific task, they must understand and be in tuned with their situational awareness; unified to the heart beat across other departments of the organization and members to accomplish the overall objectives. The future picture must drive their actions and performance to do what is needed to win. 

People must differentiate the overall sense of teamwork from the task of developing working groups that is formed to accomplish a specific goal. People confuse these two team building objectives. This is why so many team building trainings, programs and seminars, meetings, retreats and activities are deemed failures by the participants who attend. The facilitators would normally fail to define the differences of the two, “groups” and “teams,” and the participants would leave not having a comprehensive understanding for the team they would like to achieve.  Developing an overall sense of team work is much different from building an effective, focused work team when considering the approach to take to engage effective team building maneuvers. 

The Differences between Teams and Groups 

In 2007, the Bison Group’s Executive Education Training Division was launched at Temple University due to a conversation between an Adjunct Professor in the Human Resource Development department and myself. The Professor posed an interesting statement about teams and groups from one of his clients in the workplace. He started off by asking; “what is the difference between a group of people that work together towards achieving an initiative and a team doing the same?” I answered by posing a question of my own; “when does a group become a team?” This exchange stimulated a lengthy conversation and we were in agreement that the same took place with deeper meaning in the workplace. I went on to say, “the definition of a team is best described as a small group of individuals with complementary skills and abilities who are committed to a common goal and approach for which they hold each other accountable.” This definition would presume that the behaviors of a team are decidedly different from a group.    

The best size for teams is 6-12 individuals. Larger teams require more structure and support; smaller teams often have difficulty meeting when members are absent. Members have skills and abilities that complement the team’s purpose. Not all members have the same skills, but together they are greater than the sum of their parts. On teams, members share roles and responsibilities and are constantly developing new skills to improve the team’s performance. They work in a democratic fashion with every voice having an opportunity to be heard. Teams identify and reach consensus on their common goal and approach, rather than looking to a leader to define the goal and approach. Again, and most importantly, teams hold their members accountable – very accountable! What does this mean in practical terms? When they experience conflict with a member, they speak to that member directly rather than to a supervisor. When a member is not performing to the level required, the team addresses, or self disciplines, the performance issue.

As we continued on in the conversation, the Professor decided to define the groups’ perspective and functions. He went on to say, “a group can be defined as a small unit of people with complementary skills and abilities who are committed to a leader’s goal and approach and are willing to be held accountable by the leader. A group supports the leader’s goals and the leader-dominated approach to goal orientation and achievement. A group drives individual accountability rather than shared accountability. Leadership is predominantly held by one person rather than the shared, fluid leadership on a team. In a group, the dominant viewpoint is represented much different from the team’s democratic approach with voice where multiple, diverse viewpoints are represented. Decisions in a group are made by voting or implied agreement; decisions on a team are typically made by consensus.” 

When taking on the approach of defining the two, teams and groups, it is unfair to say that one is better than the other. A good question to ask would be, “when is it best to develop and use a group and when do you make the extra effort to develop a team?” It’s important to understand that groups are much easier and less complex to form than teams. Groups work best when the decisions and process are already determined, buy-in is not necessary, time is a critical factor and there is split or minimal management support for teaming. To form a group, it is best to identify a very strong and confident, effective leader and empower the person to recruit group members, formulate the goal/orientation and approach for driving decisions to be made. This approach would be practical for short-term projects where the outcomes are already defined. 

Teaming, on the other hand, should be used when you need a broad buy-in for the greatest level of performance output, when no one person has the answer and when shared responsibility is important to the success of the goal and meeting objectives. To achieve a real team is difficult and time-consuming, yet achieving a great team is almost improbable. Great teams require specific ingredients such as time, trust, positive organizational behaviors and more. There is no silver bullet or magic dust that will transform a group into a team overnight. It takes an enormous amount of time, along with lessons learned from mistakes to craft the necessary skills that work well together. And, a comprehensive understanding how to solve problems, challenges and issues when they show up – and, make the right decisions effectively. 

The conversation finished by the end of a twelve week semester with both of us coming to a common ground about teams and groups. We decided that organizations must decide on their short and long-term objectives before deciding on which direction they should journey. Also, senior leadership must be prepared to ask the people involved, “what would it take to be a real, high performance unit?” Then, as they brainstorm the answer, they must challenge the stakeholders and themselves to press onward to become the very best they can be to achieve the future picture of the organization. We also agreed that the team approach using the characteristics found within the outlined “twelve Cs for effective unit development” is the best approach organizations can use to overcome any uncertainties that lie waiting in the marketplace. The stakes are far too high and an extraordinary team of individuals will be needed to win.  

Twelve Cs for Effective Unit Development 

Most team building programs don’t achieve anything in the long term, even if they appear to have worked in the short term. Changing behavior takes time. You cannot expect people to change their behavior and continue with those changes from a two or three day training experience.

The focus of team building must be on improving results, not just improving relationships. The process starts by measuring how clear team members are on their purpose, vision, values and goals, and goes on to focus on the maneuvers and all aspects of the team dynamics for achieving those goals. 

It is important to know that no matter what you call your team-based improvement effort: continuous improvement, total quality management, lean manufacturing and Human Sigma, or self-directed work teams, you are striving to improve results for internal and external customers. Few organizations and leaders, however, are totally pleased with the results their team improvement efforts produce.

If your team improvement efforts are not living up to your expectations, the “twelve Cs for effective unit development,” a self-diagnosing checklist might tell you why. Successful team building maneuvers that develop effective, focused work teams require attention to detail in the following areas. It is important to think about the many questions posed to ensure the appropriate discussions are stimulating directional flow towards the team’s success. 

1. Clear Expectations: Has executive leadership (to be successful, there must be buy-in from the top) clearly communicated its expectations for the team’s performance and expected outcomes? Do team members understand why the team was created? Is the organization demonstrating consistency of purpose in supporting the team with resources of people, time and money? Does the work of the team receive sufficient emphasis as a priority in terms of the time, discussion, attention and interest directed its way by executive leaders? 

2. Context: Do team members understand why they are participating on the team? Do they understand how the strategy of using teams will help the organization attain its communicated business goals? Can team members define their team’s importance to the accomplishment of goal orientation? Does the team understand where its work fits in the total context of the organization’s goals, principles, posture, vision, organizational behavior and values? 

3. Commitment: Do team members want to participate on the team? Do team members feel the team mission is important? Are members committed to accomplishing the team mission and expected outcomes? Do team members perceive their service as valuable to the organization and to their own careers – is there a “win-win?” Do team members anticipate recognition for their contributions? Do team members expect their skills to grow and develop on the team? Are team members excited and challenged by the team opportunity? 

4. Competence: Does the team feel that it has the appropriate people participating? (As an example, in a process improvement initiative, is each step of the process represented on the team?) Does the team feel that its members have the knowledge, skill and capability to address the issues for which the team was formed? If not, does the team have access to the help it needs? Does the team feel it has the resources, strategies and support needed to accomplish its mission/objectives and future picture? 

5. Contract: Has the team taken its assigned area of responsibility and designed its own mission, vision, posture statement, Memorandum of Understanding and strategic intent to accomplish the mission. Has the team defined and communicated its goals; its anticipated outcomes and contributions; its timelines; and how it will measure both the outcomes of its work and the process the team followed to accomplish their task? Does the leadership team or other coordinating group support what the team has designed? 

6. Command and Control: This can be defined as the exercise of authority and direction by a properly designated team leader or members on a team over assigned and attached resources in the accomplishment of the organization’s mission. That being said, does the team have enough freedom and empowerment to feel the ownership necessary to accomplish its contract? At the same time, do team members clearly understand their boundaries? How far may members go in pursuit of solutions? Are limitations (i.e. monetary and time resources) defined at the beginning of a project before the team experiences barriers and rework? Is the team’s reporting relationship and accountability understood by all members of the organization? Has the organization defined the team’s authority? To make recommendations? To implement its plan? Is there a defined review process so both the team and the organization are consistently aligned in direction and purpose? Do team members hold each other accountable for project timelines, commitments and results? Does the organization have a plan to increase opportunities for self-management among organization members? 

7. Collaboration (Coalition of Forces): Does the team understand team and group process? Do members understand the stages of group development? Are team members working together effectively interpersonally? Do all team members understand the roles and responsibilities of team members (Concept of the “Bus”)? Team leaders? Can the team approach problem solving, process improvement, goal setting and measurement jointly? Do team members cooperate to accomplish the team contract? Has the team established group norms or rules of conduct in areas such as LeaderShaping, conflict resolution, consensus decision making and meeting management? Is the team using an appropriate strategy to accomplish its action plan? 

8. Communication: Are team members clear about the priority of their tasks? Is there an established method for the teams to give feedback and receive honest performance feedback? Does the organization provide important business information regularly? Do the teams understand the complete context for their existence? Do team members communicate clearly and honestly with each other? Do team members bring diverse opinions to the table? Are necessary conflicts raised and addressed? Do team members understand that conflict is necessary for lessons learned? 

9. Creative Innovation: Is the organization really interested in change? Does it understand the contextual implications for the change? Does it value creative thinking, transformational thinking, unique solutions and new ideation? Does it reward people who take reasonable risks to make improvements? Or does it reward the people who fit in and maintain the status quo? Does it provide the training, education, access to publications and textual resources, performance management assessments and infield trips necessary to stimulate new thinking? 

10. Consequences: Do team members feel responsible and accountable for team achievements? Do team members feel responsible and accountable for other team members? Are rewards and recognition supplied when teams are successful? Not successful? Is reasonable risk respected and encouraged in the organization? Do team members fear reprisal? Do team members spend their time finger pointing rather than resolving problems during the necessary Debrief sessions? Is the organization designing reward systems that recognize both team and individual performance and organizational behavior? Is the organization planning to share gains and increased profitability with team and individual contributors? Do team members feel responsible and accountable for team and individual strategic execution tactics? Can contributors see their impact on increased organization success? 

11. Coordination: Are teams coordinated by a central leadership team that assists the groups to obtain what they need for success? Are teams coordinated by a designated “Red Team,” one who works to employ contingency script that assists the team with working out problems and challenges as a precursor to engaging the mission? Have priorities and resource allocation been planned across departments? Have the proper configurations or reconfigurations been made and planned for across departments? Do teams understand the concept of the internal customer – the next process, anyone to whom they provide a product or a service? Are cross-functional and multi-department teams common and working together effectively and efficiently? Is the organization developing a customer-focused process-centric orientation and moving away from traditional departmental thinking? 

12. Cultural Change – Collective Behaviors: Does the organization recognize that the team-based, collaborative, empowering, enabling organizational culture of the future is different than the traditional, hierarchical organization it may currently be? Is the team a networked unit or hierarchical one? Is the organization planning to or in the process of changing how it rewards, recognizes, appraises, hires, develops, plans with, motivates and manages the people it employs? Does the organization plan to use failures for learning and support reasonable risk? Does the organization recognize that the more it can change its climate to support teams, the more it will receive in pay back (ROI) from the work of the teams? 

Spend time and attention on each of these “twelve Cs for effective unit development” to ensure your work teams contribute most effectively to your business success. In a position of leadership, your team members will respond favorably, your business will soar to new heights and empowered people will “own” and be responsible for their work processes. Everyone will find his/her voice. Can you ask for anything better in the workplace than what is proposed here? 

Accelerate Your Team Building Success with these Dynamic Publications 

People in every industry talk about team building and working as a team, but few understand how to create the experience of team building or how to develop an effective team. Many view teams as the best organization design for involving all staff associates in developing business success, productivity and profitability. The following publications have been referenced to assist you accelerate your team building maneuvers and development success. 

1. The Discipline of Teams: Small Group Performance Workbook

How to implement the disciplines, frameworks, tools, and techniques required for team building and team performance is the focus of this book by the authors of one of my favorites, “The Wisdom of Teams.” Performance is the result of both the leader and the team successfully interacting for business results, quickly. (Jon R. Katzenbach, Douglas K. Smith: John Wiley & Sons) 

2. The Five Dysfunctions of a Team

Once again using an astutely written fictional tale to unambiguously but painlessly deliver some hard truths about critical business procedures, the text targets group behavior in this entertaining, quick read filled with useful information that will prove easy to digest and implement. The text weaves lessons around the story of a troubled Silicon Valley firm and its unexpected choice for a new CEO: an old-school manager who had retired from a traditional manufacturing company two years earlier at age 55. Showing exactly how existing personnel failed to function as a unit, and precisely how the new boss worked to reestablish that essential conduct, the book's first part colorfully illustrates the ways that teamwork can elude even the most dedicated individuals--and be restored by an insightful leader. A second part offers details on the “five dysfunctions” (absence of trust, fear of conflict, lack of commitment, avoidance of accountability, and inattention to results), along with a questionnaire for readers to use in evaluating their own teams and specifics to help them understand and overcome these common shortcomings. (Patrick Lencioni: Jossey-Bass) 

3. Overcoming the Five Dysfunctions of a Team: A Field Guide for Leaders, Managers, and Facilitators

Fans have clamored for more information on how to implement the ideas outlined in The Five Dysfunctions of a Team publication, so the author answered the call. This text, “Overcoming the Five Dysfunctions of a Team,” offers more specific, practical guidance for overcoming the Five Dysfunctions, using tools, exercises, assessments and real-world examples. He examines questions that all teams must ask themselves: Are we really a team? How are we currently performing? Are we prepared to invest the time and energy required to be a great team? Written concisely and to the point, this guide gives leaders, line managers, and consultants alike the tools they need to get their teams up and running quickly and effectively. (Patrick Lencioni: Jossey-Bass) 

4. The Five Dysfunctions of a Team: Participant Workbook

Based on Patrick Lencioni’s extraordinarily successful leadership fable The Five Dysfunctions of a Team, this Participants Workbook outlines Lencioni’s powerful model and the actionable steps that can be used to overcome five common problems that may prevent your team from performing at its best: Absence of Trust, Fear of Conflict, Lack of Commitment, Avoidance of Accountability and Inattention to Results. (Patrick Lencioni: Jossey-Bass) 

5. Building Great Teams: Charting the Path of Organizational Politics

Learn how to strengthen and build your team dynamics and interpersonal communications skills; remain in control of any situation that you and your team encounter; and manage your responsibilities with tact, poise, and polish. Building great teams requires your ability to understand how to successfully chart the path of organizational politics as the essential task to achieving personal mastery and the results they influence. This text is designed for professionals who are looking for a non-traditional approach to integrating a well-defined, team-centric initiative into their organization. It facilitates a high level of professional development and demonstrates how to navigate the maze of successful team building. Using strategies from the United States Marine Corps, the text demonstrates reasons to incorporate innovative ideas and insights into core responsibilities and identifies real solutions to pressing organizational issues. You will learn to look for and see the organization behind the organization and use the insights to build and maintain support for your upcoming team-led projects. The text develops a compelling case study for your associates and the organization to understand the comprehensive approach for integrating strategic human capital and team development initiatives. Upon completion, you will receive actionable insights to emulate its approach into your existing work environment, while increasing the performance benchmarks that lie within the four critical dimensions of process improvement and effective team development: people, process, profit and profitability. (Damian D. “Skipper” Pitts: Book Surge Publishing) 

6. Building Great Teams: The Monograph

The author answers the “how-to” question for leaders across the business marketplace on building great teams with a Monograph to accompany “Building Great Teams: Charting the Path of Organizational Politics.” The text offers more specific, practical guidance for teams to chart the path of organizational politics while building greatness. The Monograph offers a blueprint for leaders and managers alike to apply a few of the disciplines found in great teams. A clear model for diagnosing and improving a team’s performance will assist beginning teams to grow. The action steps provided are the path to successful team building. Longer term teams will use these reminders for effective performance and ongoing team building. (Damian D. “Skipper” Pitts: Book Surge Publishing) 

8. Business WARFIGHTING For Great Teams

Have a team that is under performing and not living up to expectations? This team building book offers 23+ strategies and suggestions for spotting performance problems and solving them using U.S. Marine Corps-like initiatives for successful results. The text seeks to expose the future business leaders of the world to the types of training exercises that have produced generations of successful military leaders. While there are obvious differences between battlefield leadership and corporate leadership, there are also many parallels that can be drawn - especially in the constantly evolving business landscape and its use of teams. We could be nimbler in our decision-making. We could be team players, even from the top. We could lead by example. And we could actively train our subordinates to eventually lead us. Sounds like hogwash? Don’t forget that the U.S. Marines has a proven track record of success in the area of building teams that execute flawlessly and strategically – 233 years and running. (Damian D. “Skipper” Pitts and Jason G. Brown: Book Surge Publishing) 

9. Why Teams Can Fail and What to Do About It: Essential Tools for Anyone

Have a team that is under performing and not living up to expectations? This team building book offers suggestions for spotting performance problems and solving them. A long term favorite of mine, you’ll learn a lot about helping teams perform more effectively from these team building recommendations. (Darcy Hitchcock: McGraw-Hill) 

10. The 17 Indisputable Laws of Teamwork

Autocratic leadership is dead; it doesn’t work in today’s organizations; it may never have really worked. Building a sense of team work in your organization will help you win and perform. These team building lessons help you professionally and personally contribute to the team. (John C. Maxwell: Nelson, Thomas Publishers) 

11. The Performance Factor: Unlocking the Secrets of Teamwork

Pat Macmillan discusses the six components needed to produce high performance teams. This readable book provides insight into the challenges facing groups. The role of the leader in service to the team and the importance of team purpose are emphasized. (Pat Macmillan: Broadman & Holman Publishers) 

12. Skilled Facilitator: Practical Wisdom for Developing Effective Groups

You’d look a long time to find a book that defines the art and science of group facilitation as well as Schwarz in this instant classic. Starting with an introduction to group functioning, he offers insight into all aspects of groups including how to play the varying roles of the facilitator and work with different personalities and problems. (Roger M. Schwarz: Jossey-Bass) 

13. The Wisdom of Teams: Creating the High-Performance Organization

The importance of teams has become a cliché of modern business theory, but few have a clear idea of what it means. In this new edition of their best-selling primer, Katzenbach and Smith try to impart some analytical rigor to the concept. Drawing on their experience as management consultants and a plethora of case studies at companies like Burlington Northern and Motorola, they cover such topics as the optimal size of teams, coping with turnover in team personnel and nurturing “extraordinary teams” rather than “pseudo-teams.” Reacting against the touchy-feely interpersonal bent of discourse on teams, they emphasize hard-nosed principles of “performance, focus, and discipline,” over the softer concerns of “communication, openness and ‘chemistry.’” Teams, they argue, gel and achieve not by developing “togetherness,” but by tackling and surmounting specific “outcome-based” challenges (“eliminate all late deliveries...within 90 days” rather than the vaguer “develop a plan for improving customer satisfaction.”). Some of the authors’ recommendations are reasonably precise and practical, but too many are nebulous truisms (“keep the purpose, goals, and approach relevant and meaningful”) or weighed down by turgid consultant-ese (“integrating the performance goals of formal, structural units as well as special ad hoc group efforts becomes a significant process design challenge”). The case studies are better written, but it’s not clear that these inspiring anecdotes of team triumph add up to a systematic doctrine. The book leaves the impression that teams ultimately just have to learn by doing. (John R. Katzenbach and Douglas K. Smith: Collins Business) 

14. The Fifth Discipline: The Art & Practice of the Learning Organization

A director at MIT's Sloan School, Senge here proposes the “systems thinking” method to help a corporation to become a “learning organization,” one that integrates at all personnel levels indifferently related company functions (sales, product design, etc.) to “expand the ability to produce.” He describes requisite disciplines, of which systems-thinking is the fifth. Others include “personal mastery” of one’s capacities and “team learning” through group discussion of individual objectives and problems. Employees and managers are also encouraged to examine together their often negative perceptions or “mental models” of company people and procedures. The text is esoteric and flavored with terms like “re contextualized rationality,” but the book should help inventory-addled retailers whom the author cites as unaware of their customers’ desire for quality. (Peter Senge: Broadway Business)

15. The One Minute Manager Builds High-Performing Teams (Updated)

Simplistic? Absolutely! But, this team building book covers the stages of team development, how to work with a team, the importance of team leadership and more. This highly readable book is a useful beginning read about teams. It’s one that all team members will use and enjoy. (Eunice Parisi-Carew, Donald K. Carew, Kenneth H. Blanchard: Morrow/Avon) 

16. A Message To Garcia

This text written by legendary author Elbert Hubbard is widely considered to be one of the top 100 greatest books of all time. This great classic will surely attract a whole new generation of readers. For many, A Message To Garcia is required reading for various courses and curriculums. And for others who simply enjoy reading timeless pieces of classic literature, this gem by Elbert Hubbard is highly recommended. Beautifully produced, A Message To Garcia would make an ideal gift and it should be a part of everyone’s personal team building and leadership library. (Elbert Hubbard: Classic House Books)

I hope you enjoyed the article and are able to use the information to develop better working teams in your current organization. Please feel free to share this information with your colleagues to also help them with understanding their role on the teams across your organizations.

About the Author

Damian D. “Skipper” Pitts, A United States Marine turned business professional is the author of Building GREAT Teams: Charting the Path of Organizational Politics, Building GREAT Teams: The Monograph (Book Surge Publishing, 2007), the co-author of Business WARFIGHTING For GREAT Teams (Book Surge Publishing, 2008) and the Founder and Chairman of the Bison Group Corporation, a management consulting and executive education training firm. Additionally, Skipper has authored his flagship executive education program, “The Process of LeaderShaping,” that is currently being taught at 16 universities and institutions across the United States. The program includes 15 modules and 45 lectures/lessons, providing a wealth of summary, discussion, and applicable presentation material for participants to execute strategy and achieve “Personal Proficiency” and “Professional Mastery.”

Biology Genetics Question on DNA and Genes help!?

1) You wish to sequence the DNA below. However, DNA sequencing requires multiple copies of the gene.
5'-TTTTTGGCATTGAACTATGCGGGGG-3'
3'-AAAAACCGTAACTTGATACGCCCCC-5'

Identify the sequence of both primers used to
amplify the DNA sequence given using the
polymerase chain reaction technique.

2) Which restriction endonuclease would you use to excise the gene?

5'GTCGACAAGCTTAAGCCTAAGCTTTAGCGAAGCTTGTCGAC3'

I have the answers from the workbook, but can someone please explain the steps to get to the answers.

The Answer is:
1) Top Right 3’-CCCCC -5'
Bottom Left 5'-TTTTT-3'

2) SalI
- HindIII cuts in the middle of the gene.
For the first question, I dont understand how you know the length (in terms of nucleotides) of the primer.

For the second question, why is SalI used?

Hey H4,

So for your first question, when you want to amplify that specific sequence of DNA, you put a whole bunch of primers in solution that match the beginning and end of the target DNA fragment that you want to amplify. Polymerase begins to replicate the sequence towards each other. When completed, you have a brand new DNA fragment, and it's primers at the beginning and end of the sequence become the template for the next sequence to be made and so forth, until millions of copies are made. Cool stuff.

For your second question, Hind III is a restriction enzyme (protein) that has the corresponding sequence to cut (or cleave) a specific site within your DNA sequence. It cuts AAGCCT (which you can see in your gene).

Hind III cuts 5'-A A G C T T-3' with it's own sequence 3'-T T C G A A-5' with the presence of Mg2+.

When restriction enzymes cleave that specific site, usually they cut it in a specific way..in the case of Hind III, it results in what's called 'overhangs' on each end. The line below indicates where it is cut:

5'-A |A G C T T-3'

3'-T T C G A| A-5'

I'm sure you know this, but these are cleaved for a specific purpose, such as to add another few nucleotides in the sequence and stopping the production of a certain protein. Scientists are taking advantage of this for lots of different kinds of research. For example, in mapping out an organisms DNA profile and discovering differences between closely related species at a molecular level.

Hope I helped dude!

Theorytime Primer Workbook Ear Training Exercise 1